View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4760_low_12 (Length: 246)
Name: NF4760_low_12
Description: NF4760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4760_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 28 - 225
Target Start/End: Original strand, 1681124 - 1681321
Alignment:
| Q |
28 |
tatagttgctaaaataacttcctccactatggtacaaaatgtatagtttgaaacgcattattattataaaaagttttattaacagcttattcctattacc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1681124 |
tatagttgctaaaataacttcctccactatggtacaaaatgtatagtttgaaacgcattattattataaaaagttttattaacagcttattcctattacc |
1681223 |
T |
|
| Q |
128 |
acgttcaaggaagtgtggacgcaatgattttgaaaatggctctgttccaattttatagcatattggagtttgttatgggtctttttcaatgattcggg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1681224 |
acgttcaaggaagtgtggacgcaatgattttgaaaatggctctgttccaattttatagcatattggagtttgttatgggtctttttcaatgattcggg |
1681321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University