View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4760_low_15 (Length: 237)
Name: NF4760_low_15
Description: NF4760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4760_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 40188587 - 40188807
Alignment:
| Q |
1 |
gatttgttgggatgatgataaattgtggggtggcttgcattgggttttataatggttaaggttatgaaggagtggtttgttccttggaccttaatttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40188587 |
gatttgttgggatgatgataaattgtggggtggcttgcattgggttttataatggttaaggttatgaaggagtggtttgttccttggaccttaatttttg |
40188686 |
T |
|
| Q |
101 |
tgttgggaaaagaaggctaatgaatggggaacaaaattattggctttgctttcagaataccccaacatttacattgaataactatttgtaatttccaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40188687 |
tgttgggaaaagaaggctaatgaatggggaacaaaattattggctttgctttcagaataccccaacatttacattgaataactatttgtaatttccaaat |
40188786 |
T |
|
| Q |
201 |
tgcccagcatgatggtgaaat |
221 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
40188787 |
tgcccagcatgatgttgaaat |
40188807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University