View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4761-Insertion-5 (Length: 63)
Name: NF4761-Insertion-5
Description: NF4761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4761-Insertion-5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 63
Target Start/End: Original strand, 39952579 - 39952631
Alignment:
| Q |
8 |
tttggttcttttcattcttactattatccctgatttatttctcatttttattcaga |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39952579 |
tttggttcttttcattcttactat---ccctgatttatttctcatttttattcaga |
39952631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University