View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4761_high_12 (Length: 248)
Name: NF4761_high_12
Description: NF4761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4761_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 2233824 - 2234062
Alignment:
| Q |
1 |
tccccaaatgtcttataaaatgggtcctatctatccaattaatgtccatgtgaggggctcactcacgtctcttatannnnnnnnnaatctttttctaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2233824 |
tccccaaatgtcttataaaatgggtcctatctatccaattaatgtccatgtgaggggctcactcacgtctcttatattattttttaatctttttctaagg |
2233923 |
T |
 |
| Q |
101 |
tcccttatcattacaatgccatttctttttcttatccttcaatttcgacgtgccatgctttcactcttctatcggcaccaacattttgaaattcctttcc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2233924 |
tcccttatcattacaacgccatttctttttcttatccttcaatttcgacgtgccatgctttcactcttctatcggcaccaacattttgaaattcctttcc |
2234023 |
T |
 |
| Q |
201 |
ccaactaaataggatgatgatgattgatgcacctttcat |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2234024 |
ccaactaaataggacgatgatgattgatgcacctttcat |
2234062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University