View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4761_high_13 (Length: 237)
Name: NF4761_high_13
Description: NF4761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4761_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 17280980 - 17281192
Alignment:
| Q |
1 |
cattatccttatcaactgacctaaactcacggaaacactattgattcacacttaacttaactccaacaatctcattttcaattataatatgaatcttcca |
100 |
Q |
| |
|
|||||| | |||||||||| |||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17280980 |
cattattcatatcaactgagctaagctcatgagaacactattgattcacacttaacttaactccaacaatctcattttcaaatataatatgaatcttcca |
17281079 |
T |
 |
| Q |
101 |
cttcactgtattggatcaagtacacttgaatctaccgccacttctaaaccaaattaactgaattatgactctaattccaattgtcagagagtcaagagag |
200 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17281080 |
cta-----tatttgatcaagtacacttgaatctaccgccacttctcaaccaaattaactgaattatgactctaattccaattgtcggagagtcaagagag |
17281174 |
T |
 |
| Q |
201 |
ataacaccatgagctaca |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
17281175 |
ataacaccatgagctaca |
17281192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University