View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4761_high_15 (Length: 220)
Name: NF4761_high_15
Description: NF4761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4761_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 6855826 - 6855613
Alignment:
| Q |
1 |
cttttgtaagtaaggaagctacttagtagaaggaattaaggtgaagttttatctttaatgagtaactgttattggatattgagtagtgttgcaacatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6855826 |
cttttgtaagtaaggaagctacttagtagaaggaattaaggtgaagttttatctttaatgagtaactgttatcggatattgagtagtgttgcaacatgca |
6855727 |
T |
|
| Q |
101 |
aaggaagttttctgagttatgttttaagaaactttgtgaattgaactatatacacatagacactgtatctggagttcttgtttgtgattaagtggaaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855726 |
aaggaagttttctgagttatgttttaagaaactttgtgaattgaactatatacacatagacactgtatctggagttcttgtttgtgattaagtggaaatg |
6855627 |
T |
|
| Q |
201 |
ccaggcccctatgg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6855626 |
ccaggcccctatgg |
6855613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University