View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4761_low_10 (Length: 263)
Name: NF4761_low_10
Description: NF4761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4761_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 49 - 248
Target Start/End: Complemental strand, 17280924 - 17280726
Alignment:
| Q |
49 |
tgaatcaatagtgggatg-ttttaaattcactagattattgtcccttctcttatatatatttcatttaggatggggctggtttaaaaatttatttagtga |
147 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17280924 |
tgaatcaatagtgggatggttttaaattcactagattattgtctcttctcttatatatatttcatttaggatggggctggtttaaaaatttatttagtga |
17280825 |
T |
 |
| Q |
148 |
gataacataatagttatgttttcacacaagaaaatagtttaagggaaagatgtagtgtcaaaatctttcaataatacaagtcttttaacctttgatactc |
247 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17280824 |
gataacataatagttttgttttcacacaagaaaatagtttaaggtaaagatgtagtgtcaaaatctttcaataatac--gtcttttaacctttgatactc |
17280727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 17280976 - 17280940
Alignment:
| Q |
1 |
aatatatgtaaggtgcggggtttgaacccagacacca |
37 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
17280976 |
aatatatgcaaggtgcggggtttgaacccagaaacca |
17280940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University