View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4761_low_12 (Length: 251)
Name: NF4761_low_12
Description: NF4761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4761_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 5 - 107
Target Start/End: Complemental strand, 4226884 - 4226782
Alignment:
| Q |
5 |
gagtgagatgaaatacatcagataaattttaaagagactaacacaactaatctttctcaagggtttctttagaaataggtaattatgttgaatcacggtt |
104 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4226884 |
gagtgaaatgaaatacatccgataaattttaaagagactaacacaactaatctttctcaagggtttctttagaaataggtaattatgttgaatcacggtt |
4226785 |
T |
|
| Q |
105 |
acc |
107 |
Q |
| |
|
||| |
|
|
| T |
4226784 |
acc |
4226782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 182 - 243
Target Start/End: Complemental strand, 4226706 - 4226645
Alignment:
| Q |
182 |
tgaagttgatgtatccatcacttagtgacatccatctaagcaccaacttggtaattaagcaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4226706 |
tgaagttgatgtatccatcacttagtgacatccatcgaagcaccaacttggtaattaagcaa |
4226645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University