View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4761_low_17 (Length: 215)
Name: NF4761_low_17
Description: NF4761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4761_low_17 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 3 - 215
Target Start/End: Original strand, 2233616 - 2233828
Alignment:
| Q |
3 |
tggaaattttgtaggtgtataatcttagaaaaatatttcaaaatattgagagacgaaatcaatgttatacagatttttgaaaggcatgcatgtatgtatc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2233616 |
tggaaattttgtaggtgtataatcttagaaaaatatttcaaaatattgagagacgaaatcaatgttatacagatttttgaaaggcatgcatgtatgtatc |
2233715 |
T |
 |
| Q |
103 |
atgtataattgaaacagtgatgtatttgctaacgtaatacccatcaagcagagtggcaacaacagaagtttttgtggtcgaaagcttgtgaccaagttac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2233716 |
atgtataattgaaacagtgatgtatttgctaacgtaatacccatcaagcagagtggcaacaacagaagtttttgtggtcgaaagcttgtgaccaagtcac |
2233815 |
T |
 |
| Q |
203 |
ctactctgtcccc |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2233816 |
ctactctgtcccc |
2233828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University