View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4761_low_6 (Length: 308)
Name: NF4761_low_6
Description: NF4761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4761_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 7 - 202
Target Start/End: Original strand, 11802638 - 11802833
Alignment:
| Q |
7 |
cataggtaatatcaatatccctttagcaagagaattatcaaaataatatgtgtttcaccaaagttgaatttcaagtttgtcggaattcggataaactcaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
11802638 |
cataggtaatatcaatatccctttagcaagagaattatcaaaataatatgtgtttcaccaaagttgaatttcgagtttgtcggaattccgataaactcaa |
11802737 |
T |
 |
| Q |
107 |
ttcaagtttgttagaatataaaatgtgtttaggtaaagtagaatttcaatttcgtcggaacaaacttaactaaattttattaagtattgaacaaac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11802738 |
ttcaagtttgttagaatataaaatgtgttcaggcaaagtagaatttcaatttcgtcggaacaaacttaactaaattttattaagtattgaacaaac |
11802833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 11802890 - 11802923
Alignment:
| Q |
260 |
cattaatgtagagacttaattttatgtgcattgt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11802890 |
cattaatgtagagacttaattttatgtgcattgt |
11802923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University