View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4762-Insertion-3 (Length: 172)
Name: NF4762-Insertion-3
Description: NF4762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4762-Insertion-3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 3e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 3e-34
Query Start/End: Original strand, 95 - 172
Target Start/End: Original strand, 41868517 - 41868594
Alignment:
| Q |
95 |
ttcttaaatctactcattttactcaattcaccacacaataattgattatctacaacaaaaagaatattgaaataattg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41868517 |
ttcttaaatctactcattttactcaattcaccacacaataattgattatctataacaaaaagaatattgaaataattg |
41868594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University