View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4763-Insertion-20 (Length: 291)
Name: NF4763-Insertion-20
Description: NF4763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4763-Insertion-20 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 140 - 291
Target Start/End: Complemental strand, 4261749 - 4261601
Alignment:
| Q |
140 |
tgaacactcaggtattttcatctggtatataacaaatcttgtttaaggtttctactttaggcttggtcaacgataactagatgtgaggaggaaaagagat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4261749 |
tgaacactcaggtattttcatctggtata---caaatcttgtttaaggtttctactttaggcttggtcaacgctaactagatgtgaggaggaaaagagat |
4261653 |
T |
|
| Q |
240 |
taaaagtcaaaagattaagcagagtacatccagcatccaacctcatatctcg |
291 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
4261652 |
taaaagtcataagatttagcagagtacatccaacatctaacctcatatctcg |
4261601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 15 - 71
Target Start/End: Complemental strand, 4261874 - 4261818
Alignment:
| Q |
15 |
ggtatgcacgtaattgaattcacttgcaggtttaagtgaattcagctcaaatgatag |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261874 |
ggtatgcacgtaattgaattcacttgcaggtttaagtgaattcagctcaaatgatag |
4261818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University