View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4763-Insertion-21 (Length: 237)
Name: NF4763-Insertion-21
Description: NF4763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4763-Insertion-21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 234
Target Start/End: Complemental strand, 51383117 - 51382893
Alignment:
| Q |
8 |
taatttgtaagctgattttagtttggtctggtgacatagcatatttgtgtaatactatttgtaactaaatttagtttggtctatgacatagcatatttgt |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51383117 |
taatttgta-gctgattttagtttggtctg-tgacatagcatatttgtgtaatactatttgtaactaaatttagtttggtctatgacatagcatatttgt |
51383020 |
T |
|
| Q |
108 |
gtaatacatgagtggatccatgatcaccatataacttatttgagaacaattcttttattatgatatatcttattggtggttgttaaaattggtataaccc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
51383019 |
gtaatacatgagtggatccatgatcaccatataacttatttgagaacaattcttttattatgatatatcttattggtagttgttaaaattggtatgaccc |
51382920 |
T |
|
| Q |
208 |
atgcagccgaaagttcccatttgctgc |
234 |
Q |
| |
|
|||| || ||||||||||||||||||| |
|
|
| T |
51382919 |
atgcggcagaaagttcccatttgctgc |
51382893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 3551339 - 3551250
Alignment:
| Q |
122 |
gatccatgatcaccatataacttatttgagaacaattcttttattatgatatatcttattggtggttgttaaaattggtataacccatgca |
212 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||| |||||||||||||||||| ||||||| | |||||||||| ||||| |||| |||| |
|
|
| T |
3551339 |
gatccatgattaccatataacttattcgacaaca-ttcttttattatgatatagcttattgacgattgttaaaatcggtatgacccgtgca |
3551250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 3583584 - 3583495
Alignment:
| Q |
122 |
gatccatgatcaccatataacttatttgagaacaattcttttattatgatatatcttattggtggttgttaaaattggtataacccatgca |
212 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||| ||||||||||||| ||||| |||||| ||||||||||| ||||| |||| |||| |
|
|
| T |
3583584 |
gatccatgattaccatataacttattcgaaaaca-ttcttttattatggtatatattattgacagttgttaaaatcggtatgacccgtgca |
3583495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 115
Target Start/End: Complemental strand, 3554907 - 3554859
Alignment:
| Q |
67 |
tgtaactaaatttagtttggtctatgacatagcatatttgtgtaataca |
115 |
Q |
| |
|
||||||||||| ||||||||| | | ||||||||||||| ||||||||| |
|
|
| T |
3554907 |
tgtaactaaatatagtttggtatgtaacatagcatatttatgtaataca |
3554859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 115
Target Start/End: Complemental strand, 3584514 - 3584466
Alignment:
| Q |
67 |
tgtaactaaatttagtttggtctatgacatagcatatttgtgtaataca |
115 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
3584514 |
tgtaactaaatatagtttggtccgtaacatagcatatttatgtaataca |
3584466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University