View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4763_high_12 (Length: 211)
Name: NF4763_high_12
Description: NF4763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4763_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 7436208 - 7436381
Alignment:
| Q |
20 |
acacctgagggatgaatctagctagctaggcaatgatcttctttggtcccaagattccatttccatatctacttgatcaatggacacatgtcacatattt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7436208 |
acacctgagggatgaatctagctagctaggcaatgatcttctttggtcccaagattccatttccatatctacttgatcaatggacacatgtcacatattt |
7436307 |
T |
 |
| Q |
120 |
tatggctatcacatgtctcatttttgtataacacattaaattttctttgattaactcaattagtacccaatgtt |
193 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7436308 |
tatgcctatcacatgtctcatttttgtataacacattaaattttctttgattaactcaattagtacccaatgtt |
7436381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 41 - 147
Target Start/End: Original strand, 7450323 - 7450429
Alignment:
| Q |
41 |
ctagctaggcaatgatc----ttctttggtcccaagattccatttccatatctacttgatcaatggacacatgtcacatattttatggctatcacatgtc |
136 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| || || | ||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7450323 |
ctagctaggcaatgatcgattttctttggtcccaagattccatttccacttcc-ctc---ccatggacacatgtcccatattttatgcctatcacatgtc |
7450418 |
T |
 |
| Q |
137 |
tcatttttgta |
147 |
Q |
| |
|
| ||||||||| |
|
|
| T |
7450419 |
ttatttttgta |
7450429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University