View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4764_low_11 (Length: 216)
Name: NF4764_low_11
Description: NF4764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4764_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 13 - 200
Target Start/End: Original strand, 30883340 - 30883527
Alignment:
| Q |
13 |
gaagaagatgagttgttggtatccatcggaccagtgtttacctaagtagaagaaagtgaaggaaatgaagaagaaaacaacgattttgagagcgttggtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30883340 |
gaagaagatgagttgttggtatccatcggaccagtgtttgcctaagtagaagaaagtgaaggtaatgaagaagaaaacaacgattttgagagcgttggtt |
30883439 |
T |
 |
| Q |
113 |
gttttgagaaaatcgacattgattggtgatttcatagtttgatttatggatcggagtactagttcatgaatttgtcacatctgagatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30883440 |
gttttgagaaaatcgacattgattggtgatttcatagtttgatttatggatcggagtactagttaatgaatttgtcacatctgagatg |
30883527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University