View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4764_low_12 (Length: 203)
Name: NF4764_low_12
Description: NF4764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4764_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 9126837 - 9127009
Alignment:
| Q |
18 |
gcatgatgaacaaatagtcgcccctttgattaatatgtaaatatatttcaatctaaatacaaaaggaaatcactaacagctcttcaagaaaacaaaagac |
117 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9126837 |
gcatgatgatcaaatggtcgcccctttgattaatatgtgaatagatttcaatctaaatacaaaaggaaatcactaacagatcttcaagaaaacaaaagac |
9126936 |
T |
 |
| Q |
118 |
aactaatatttcatttgtctaataaaatatatcttctgtcaaagtcatcagagtctttgtcactcgtctctgc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9126937 |
aactaatatttcatttgtctaataaaatatatcttttgtcaaagtcatcagagtctttgtcactcgtctctgc |
9127009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University