View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4765-Insertion-6 (Length: 46)
Name: NF4765-Insertion-6
Description: NF4765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4765-Insertion-6 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.00000000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 31330666 - 31330628
Alignment:
| Q |
8 |
gaagttgggattcaccagcaccaattgagagtgttcata |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31330666 |
gaagttgggattcaccagcaccaattgagagtgttcata |
31330628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 31379448 - 31379410
Alignment:
| Q |
8 |
gaagttgggattcaccagcaccaattgagagtgttcata |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31379448 |
gaagttgggattcaccagcaccaattgagagtgttcata |
31379410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University