View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4766-Insertion-13 (Length: 371)
Name: NF4766-Insertion-13
Description: NF4766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4766-Insertion-13 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 212 - 371
Target Start/End: Original strand, 2914322 - 2914485
Alignment:
| Q |
212 |
atataaaatccg-aatattagaatttagaaacaatcaagcgcgannnnnnnaaaacaacaaaattaagatgaaatcaaaccgtccaatcacacttggtaa |
310 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2914322 |
atataaaatccccaatattagaatttagaaacaatcaagcgcgatttttttaaaacaacaaaattaagatgaaatcaaaccgtccaatcacacttggtaa |
2914421 |
T |
|
| Q |
311 |
atttacaagttata--attttcttccaaaa-atctcaatcccaaataacgctcaactaaacaac |
371 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||| |||| ||||||||| |
|
|
| T |
2914422 |
atttacaagttataatattttcttccaaaagatctcaatcccaaataacactcacctaaacaac |
2914485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 137 - 220
Target Start/End: Original strand, 2914054 - 2914137
Alignment:
| Q |
137 |
ctatcagttatcacacatgtactggaacaaaattaccgaaaattcagcaaacttaatcccaaaattgtcgcataaatataaaat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2914054 |
ctatcagttatcacacatgtactggaacaaaactaccgaaaattcagcaaacttaatcctaaaattgtcgcataaatataaaat |
2914137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University