View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4766-Insertion-15 (Length: 237)
Name: NF4766-Insertion-15
Description: NF4766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4766-Insertion-15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 44548724 - 44548495
Alignment:
| Q |
8 |
acaaataaacaagggagcaaatttacacaccccaatatcaactccgatatacacatccagtaaaaacatgaactttgtgacacttctgattctggaaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548724 |
acaaataaacaagggagcaaatttacacaccccaatatcaactccgatatacacatccagtaaaaacatgaactttgtgacacttctgattctggaaaca |
44548625 |
T |
 |
| Q |
108 |
ccgatgaatatgtagaaattaaagataggggtggagaaatttgctccaataaaaaggtctatatgtaacgtaagccatgataaagataatggattctttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548624 |
ccgatgaatatgtagaaattaaagataggggtggggaaatttgctccaataaaaaggtctatatgtaacgtaagccatgataaagataatggattctttt |
44548525 |
T |
 |
| Q |
208 |
tgcactcgtcttccaaacaatatttttgca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44548524 |
tgcactcgtcttccaaacaatatttttgca |
44548495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University