View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4766-Insertion-18 (Length: 155)
Name: NF4766-Insertion-18
Description: NF4766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4766-Insertion-18 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 11 - 155
Target Start/End: Complemental strand, 50984066 - 50983920
Alignment:
| Q |
11 |
ggaacatttcccccttacccttatatttt--atgctttcatttctttattaaaaggcaaaatggaataaacaaagcacacaatcaagaacaaaatatgca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
50984066 |
ggaacatttcccccttacccttatattttttatgctttcatttctttattaaaaggcaaaatggaataaataaagcacacaatcaagaacaaaatataca |
50983967 |
T |
|
| Q |
109 |
gggaaaacgaagtcaaacatgacacaaaacaaaatcacttgcagata |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50983966 |
gggaaaacgaagtcaaacatgacacaaaacaaaatcacttgcagata |
50983920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 11 - 155
Target Start/End: Complemental strand, 51087200 - 51087054
Alignment:
| Q |
11 |
ggaacatttcccccttacccttatatttt--atgctttcatttctttattaaaaggcaaaatggaataaacaaagcacacaatcaagaacaaaatatgca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
51087200 |
ggaacatttcccccttacccttatattttttatgctttcatttctttattaaaaggcaaaatggaataaataaagcacacaatcaagaacaaaatataca |
51087101 |
T |
|
| Q |
109 |
gggaaaacgaagtcaaacatgacacaaaacaaaatcacttgcagata |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51087100 |
gggaaaacgaagtcaaacatgacacaaaacaaaatcacttgcagata |
51087054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University