View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4766_low_14 (Length: 305)
Name: NF4766_low_14
Description: NF4766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4766_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 117 - 302
Target Start/End: Original strand, 43962690 - 43962875
Alignment:
| Q |
117 |
gggttaaatttttatcacgcattgtgaatctgacggaatgattttgggcaatccttatgatggaccggcttcctcatgttcctcgaacctcctaaggcct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43962690 |
gggttaaatttttatcacgcattgtgaatctgacggaatgatttttggcaatccttatgatggaccggcttcatcatgttcctcgaacctcctaaggcct |
43962789 |
T |
 |
| Q |
217 |
tagcaaaacaattgtttaaagaagctgaataataatattcatggtgtgcagatgaatggtggaaatcttcatcgtttgcctttgct |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43962790 |
tagcaaaacaattgtttaaagaagctgaataataatattcatggtgtgcagatgaatggtggaaatcttcatcgtttgtctttgct |
43962875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University