View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4766_low_25 (Length: 207)
Name: NF4766_low_25
Description: NF4766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4766_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 190
Target Start/End: Complemental strand, 48660866 - 48660686
Alignment:
| Q |
14 |
gtaacaaaggtgcaacttcactcaccgccc----acatttttaaataagcacgcataattttcggaagtgtacttccgtgcacatctggacagcacaaaa |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48660866 |
gtaacaagggtgcaacttcactcaccgcccgcccacatttttaaataagcacgcataattttcggaagtgtacttccgtgcacatctggacagcacaaaa |
48660767 |
T |
|
| Q |
110 |
actgtgttttctttcaaatgtaaagtgttttgggatgggaaaagttcctcataacaaacaatgcatgtgggcaggggtaag |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48660766 |
actgtgttttctttcaaatgtaaagtgttttgggatgggaaaagttcctcataacaaacaatgcatgtgggcaggggtaag |
48660686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University