View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4767_high_4 (Length: 332)
Name: NF4767_high_4
Description: NF4767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4767_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 58 - 326
Target Start/End: Complemental strand, 16672274 - 16672008
Alignment:
| Q |
58 |
gtttctctaattgtatttgcaactttataattgagcccgattataaaaaatgtctctctctcnnnnnnnnnnnnnnntttaccccgattataggtctctt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||||||| |
|
|
| T |
16672274 |
gtttctctaattgtatttgcaactttataattgagcccgattataaaaaatgtttctctca-aaaaaaaaaaaaaaattgagcccgattataggtctctt |
16672176 |
T |
|
| Q |
158 |
gatcgctaataataattcttgttgaatatataaataaaaggattagtcatattaggcttctacttatgtctcatcttactcctcttggttgctgttttga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16672175 |
gatcgctaataataattcttgttgaatatataaataaaaggattagtcatattaggcttctacttatgtctcatcttactcctcttggttgctgttttga |
16672076 |
T |
|
| Q |
258 |
gtagatcactatcgaattaggcttcacttgtggtgttgatcccaataacgtttttgtgtcctatgcttc |
326 |
Q |
| |
|
|||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16672075 |
gtagatcactattgaattaggctttggttgt-gtgttgatcccaataacgtttttgtgtcctatgcttc |
16672008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University