View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4767_low_10 (Length: 237)
Name: NF4767_low_10
Description: NF4767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4767_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 37503858 - 37504067
Alignment:
| Q |
11 |
catcatcattatctactctaataataatatcaaactctcctacattatgtgaccctaatcctctcccaacagcattatcagagctttctgtatgtccttg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37503858 |
catcatcattatctactctaataataatatcaaactctcctacattatgtgaccctaatcctctcccaacagcattatcagagctttctgtatgtccttg |
37503957 |
T |
|
| Q |
111 |
attctgagtctcaacagaaatatttgaaattgaatcaagttgatcagtgactgtgatactcacctctgcagcatcattgatcacaggtgcacgacacagc |
210 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37503958 |
attctgagtgtcaccagaaatatttgaaattgaatcaagttgatcagtgactgtgatactcacctctgcagcatcattgataacaggtgcacgacacagc |
37504057 |
T |
|
| Q |
211 |
ggacaattct |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
37504058 |
ggacaattct |
37504067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University