View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4767_low_6 (Length: 332)

Name: NF4767_low_6
Description: NF4767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4767_low_6
NF4767_low_6
[»] chr8 (1 HSPs)
chr8 (58-326)||(16672008-16672274)


Alignment Details
Target: chr8 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 58 - 326
Target Start/End: Complemental strand, 16672274 - 16672008
Alignment:
58 gtttctctaattgtatttgcaactttataattgagcccgattataaaaaatgtctctctctcnnnnnnnnnnnnnnntttaccccgattataggtctctt 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||                 || | ||||||||||||||||||    
16672274 gtttctctaattgtatttgcaactttataattgagcccgattataaaaaatgtttctctca-aaaaaaaaaaaaaaattgagcccgattataggtctctt 16672176  T
158 gatcgctaataataattcttgttgaatatataaataaaaggattagtcatattaggcttctacttatgtctcatcttactcctcttggttgctgttttga 257  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16672175 gatcgctaataataattcttgttgaatatataaataaaaggattagtcatattaggcttctacttatgtctcatcttactcctcttggttgctgttttga 16672076  T
258 gtagatcactatcgaattaggcttcacttgtggtgttgatcccaataacgtttttgtgtcctatgcttc 326  Q
    |||||||||||| |||||||||||   |||| |||||||||||||||||||||||||||||||||||||    
16672075 gtagatcactattgaattaggctttggttgt-gtgttgatcccaataacgtttttgtgtcctatgcttc 16672008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University