View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4768_high_4 (Length: 375)
Name: NF4768_high_4
Description: NF4768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4768_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 16 - 370
Target Start/End: Complemental strand, 30737626 - 30737279
Alignment:
| Q |
16 |
gaaggatcttcacagacatgacttattatgcttgggtcaaggcataatttaacatg-atgtatataaaacatctatgatgcttcttttgtattggaggct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30737626 |
gaaggatcttcacagacatgacttattatgcttgagtcaaggcataagttaacatggatgtatataaaacatctatgatacttcttttgtattggaggct |
30737527 |
T |
 |
| Q |
115 |
tccaatagattttgtgtccttgcttcaatgatgaattcattgcatagtgtttacatcgagagatgtaagttggctcggatgtatttaaaacattcgagac |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30737526 |
tccaatagatttcgtgtccttgcttcaaggatgaattcattccatagtgtttacat--------gtaagttggctcggatgtatttaaaacattcgagac |
30737435 |
T |
 |
| Q |
215 |
caggcatttttctacaaatgctcgacttggtttttactgaattaaaccaatgatggggtagaggaaccttgatcttcccttcattattgaattagaggaa |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30737434 |
caggcatttttctacaaatgctcgacttggtttttcctgaattaaaccaatgatggggtagaggaaccttgatcttcccttcattattgaattagaggaa |
30737335 |
T |
 |
| Q |
315 |
caattgttccatcagaggatcgattacatgactcagatttcttagcctttgcttct |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
30737334 |
caattgttccatcagaggatcgattacatgactcagatttcttagccattgtttct |
30737279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University