View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4768_low_11 (Length: 249)
Name: NF4768_low_11
Description: NF4768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4768_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 29878543 - 29878774
Alignment:
| Q |
1 |
cacatatgtttgacttttttggattgattattattatgataagagttgtagctggaccctttaaatcttt-atttattttttgtaaatgtcaaaatcatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29878543 |
cacatatgtttgacttttttggattgattattattatgataagagttgtagctggaccctttaaatcttttatttattttttgtaaatgtcaaaatcatt |
29878642 |
T |
 |
| Q |
100 |
atttggtgtcaataattgctatatataatgttggtaaggcatgaaattaag---tagtgagcaaataaaaacacatagatcgaaatgaatatcatgcagc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29878643 |
atttggtgtcaataattgctatatataatgttggtaaggcatgaaattaagtactagtgagcaaataaaaacacatagatcgaaatgaatagcatgcagc |
29878742 |
T |
 |
| Q |
197 |
tgaaatgaaggaaatagctaggaggaatcatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29878743 |
tgaaatgaaggaaatagctaggaggaatcatg |
29878774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University