View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4768_low_16 (Length: 217)
Name: NF4768_low_16
Description: NF4768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4768_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 42690048 - 42690232
Alignment:
| Q |
17 |
gagaagaaagaacgagaggtgttagagaaggtggagatggcctggcgaatgcgtggcgtgtttgtggaaggccacgtagagtgacatatatttgtccata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42690048 |
gagaagaaagaacgagaggtgttagagaaggtggagatgacctggcgaatgcgtggcgtgtttgtggaaggccacgtggagtgacatatatttgtccata |
42690147 |
T |
 |
| Q |
117 |
aatggtcgtgtgatgagaggttgttaagctgagagcacgtgctggctgcagaagcaagtgaagaaccgtcaaggcacgtgaggat |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42690148 |
aatggtcgtgtgatgagagggtgttaagctgagagcacgtgctggctgcagaagcaagtgaagaaccgtcaaggtacgtgaggat |
42690232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University