View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4769-Insertion-10 (Length: 76)
Name: NF4769-Insertion-10
Description: NF4769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4769-Insertion-10 |
 | |
|
| [»] chr8 (4 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 3e-29; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 10266524 - 10266592
Alignment:
| Q |
8 |
tcagcatcctttgttagactctcaaattcttctatcaccttttccaagtcaaacttttcaattatttcc |
76 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10266524 |
tcagcatcctgtgttagactctcaaattcttctatcaccttttccaagtcaaacttttcaattatttcc |
10266592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 10274281 - 10274349
Alignment:
| Q |
8 |
tcagcatcctttgttagactctcaaattcttctatcaccttttccaagtcaaacttttcaattatttcc |
76 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||| || ||| |||||||| |
|
|
| T |
10274281 |
tcagcatcctttgttagcctctcaaattcttctatcaccttttccatgtcaaatttctcagttatttcc |
10274349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 10244555 - 10244623
Alignment:
| Q |
8 |
tcagcatcctttgttagactctcaaattcttctatcaccttttccaagtcaaacttttcaattatttcc |
76 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||| |||||| || |||||||||||| |
|
|
| T |
10244555 |
tcagcatcctttgttagcctctcaaattcttctatcaagttttccatgtcaaatttctcaattatttcc |
10244623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 10286086 - 10286136
Alignment:
| Q |
8 |
tcagcatcctttgttagactctcaaattcttctatcaccttttccaagtca |
58 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
10286086 |
tcagcatcctttgttagcctctcaaattcttctaccaccttttccaagtca |
10286136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University