View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4769_high_3 (Length: 313)
Name: NF4769_high_3
Description: NF4769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4769_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 44965732 - 44965850
Alignment:
| Q |
1 |
agttctccggcgaacaggagtgatgatacgctgttgcagcagcatgatggaattcaaagtgctattcttcattgcaagagatccttcaattccagaggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965732 |
agttctccggcgaacaggagtgatgatacgttgttgcagcagcatgatggaattcaaagtgctattcttcattgcaagagatccttcaattccagaggta |
44965831 |
T |
|
| Q |
101 |
aaatttgtttcaaaattgg |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44965832 |
aaatttgtttcaaaattgg |
44965850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 184 - 298
Target Start/End: Original strand, 44965915 - 44966029
Alignment:
| Q |
184 |
cagattcttcaatgggtgttgatgttgacggatcaatgtattcgacaagaaactcttttgaggatgaagtgtgatgtattgaactcaacatagaaagaaa |
283 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965915 |
cagattcttcaatgggtgttgatgctgacggatcaatgtattcgacaagaaactcttttgaggatgaagtgtgatgtattgaactcaacatagaaagaaa |
44966014 |
T |
|
| Q |
284 |
atagagagaagagta |
298 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44966015 |
atagagagaagagta |
44966029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 90
Target Start/End: Original strand, 2502541 - 2502611
Alignment:
| Q |
20 |
gtgatgatacgctgttgcagcagcatgatggaattcaaagtgctattcttcattgcaagagatccttcaat |
90 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||||| | || ||| | || |||||||||||||||||| |
|
|
| T |
2502541 |
gtgatgattcgcttttgcagcagcaagatggaattcaaggagccattttacactgcaagagatccttcaat |
2502611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University