View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4769_high_4 (Length: 231)
Name: NF4769_high_4
Description: NF4769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4769_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 44965713 - 44965492
Alignment:
| Q |
1 |
cgatcacctactctcacccagatgcttggtgccccctcaccacccggccggaacacccccgggtttctcttccctaaaagagccaaccgccggtgaagac |
100 |
Q |
| |
|
|||| ||||||||| ||||| |||||| || || ||| | ||| ||||||| || ||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
44965713 |
cgatgacctactcttacccaaatgcttcgttaccactctcatcccagccggaaaactcccctgtttctctttcctcaaagagccaaccgccggtgaagac |
44965614 |
T |
 |
| Q |
101 |
gacggcgaagccgtcactgtcatcccctcgccggagaatttcaccttatcaccatacctcttcgaaaccttaacataaagaggcttaatcagcttcaaat |
200 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965613 |
gacggtgaagctgtcactgtcatcccctcgccggagaatttcaccttatcaccatacctcttcgaaaccttaacataaagaggcttaatcagcttcaaat |
44965514 |
T |
 |
| Q |
201 |
atttctgcaaaatctcctttga |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44965513 |
atttctgcaaaatctcctttga |
44965492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University