View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4769_low_5 (Length: 218)
Name: NF4769_low_5
Description: NF4769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4769_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 19 - 172
Target Start/End: Complemental strand, 27770391 - 27770237
Alignment:
| Q |
19 |
atcagagatgtagaaagaaacatatgtgtctttcctactattaaggaagatgatccttgtctacaacattactcggttattaattaat---atgattcag |
115 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
27770391 |
atcagagatgtaaaaagaaa--tatgtgtctttcctactattaaggaagatgatccttgtctacaacatttctcggttattaattaatcagatgattcag |
27770294 |
T |
|
| Q |
116 |
accgttcatgttttgattgagttgaaaccaaagaaaataaaatcttgttaattaggt |
172 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27770293 |
accgttcttgttttgattgagttgaaaccaaacaaaataaaatcttgttaattaggt |
27770237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University