View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4770_high_2 (Length: 495)
Name: NF4770_high_2
Description: NF4770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4770_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 275; Significance: 1e-153; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 167 - 481
Target Start/End: Original strand, 5465740 - 5466054
Alignment:
| Q |
167 |
cgtaataaaacactacccacaatcccaaaacccgtttcgacccgtaacccggttaatcacgccccggctattctctccccggctgattctcatctaaacc |
266 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
5465740 |
cgtaataaaacaccacccacaatcccaaaacccgtttcgacccgtaaccccgttacccacgccccggccattctctcaccggctgattctcatctaaacc |
5465839 |
T |
|
| Q |
267 |
gacctgacgataatgactcaaccccaactctcttttccaaacctgcgtcccatgatgacccgaaccagttcttggagtcgggtcagtgtgtgatgaatga |
366 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465840 |
gacctgacgataatgactcaactccaactctcttttccaaaccagcgtcccatgatgacccgaaccagttcttggagtcgggtcagtgtgtgatgaatga |
5465939 |
T |
|
| Q |
367 |
tgatatggtggagagggatcattttgtttcggatacccgtcccgaattaggtggcttggacctgtttacgccttgtagtaattttatgcagaagaagatg |
466 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5465940 |
tgatatggtggagagggatcattttgtttcggatacccgtcccgaattaggtgccttggacctgtttacgccttgtagtagttttatgcagaagaagatg |
5466039 |
T |
|
| Q |
467 |
aaaccgcagtatgat |
481 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5466040 |
aaaccgcagtatgat |
5466054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 9 - 83
Target Start/End: Original strand, 5465582 - 5465656
Alignment:
| Q |
9 |
acatatgaatctatctaactaactctgtacttattcttcttttgttcacacaatacatagtattgcaaatgcatg |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465582 |
acatatgaatctatctaactaactctgtactaattcttcttttgttcacacaatacatagtattgcaaatgcatg |
5465656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University