View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4771-Insertion-3 (Length: 144)
Name: NF4771-Insertion-3
Description: NF4771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4771-Insertion-3 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 7e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 7e-44
Query Start/End: Original strand, 5 - 144
Target Start/End: Complemental strand, 9029176 - 9029035
Alignment:
| Q |
5 |
acacccattaccattccccataataaa-atgtacaaatgcctataagt-caaatgcataacccaatccagctgaaatcatttcatagctccctcccacaa |
102 |
Q |
| |
|
|||| |||||||||| ||||||||||| |||||||||| | ||||||| || |||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9029176 |
acactcattaccatttcccataataaatatgtacaaatacatataagtacagttgcataacccaatccatctgaaatcatttcagagctccctcccacaa |
9029077 |
T |
|
| Q |
103 |
atggcgatttttcgtttgataataaactaagagtagtataaa |
144 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9029076 |
atggcgatttttcgtttgataagaaactaagagtagtataaa |
9029035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University