View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4771_high_3 (Length: 366)
Name: NF4771_high_3
Description: NF4771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4771_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 77 - 348
Target Start/End: Complemental strand, 54088258 - 54087991
Alignment:
| Q |
77 |
aggtcctttcttgctgctctactttcacatgcaataacattcattgcaacaagcaaagaaacaacagctaaaatcttcattgaagccattgtcacggatc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088258 |
aggtcctttcttgctgctctactttcacatgcaataacattcattgcaacaagcaaagaaacaacagctaaaatcttcattgaagccattgtcacggatc |
54088159 |
T |
|
| Q |
177 |
aaacaataaaaggcaaatatatatatcagcacgtttgaacttatctaaagccaatattgatttagagattgaaatgttttaattgtagagaagtatgttg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088158 |
aaacaataaaaggcaaatatatatatcagcacgtttgaacttatctaaagccaatattgatttagagattgaaatgttttaattgtagagaagtatgttg |
54088059 |
T |
|
| Q |
277 |
agatatgcatgctatttatagatgagattatgatagctagcgctaatgtacgtcggcaagcatgtgtaaaag |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088058 |
agatatgcatgctatttatagatgagattatga----tagcgctaatgtacgtcggcaagcatgtgtaaaag |
54087991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University