View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4771_high_5 (Length: 325)
Name: NF4771_high_5
Description: NF4771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4771_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 208 - 301
Target Start/End: Complemental strand, 8158142 - 8158049
Alignment:
| Q |
208 |
gaaggagtgttaaaattattattcactactggagttaatgtgtccttaaggcttcatatataagacgttccgacttcatgcattgaataccatg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8158142 |
gaaggagtgttaaaattattattcactactggagttaatgtgtccttaaggcttcatatataagacgttccgacttcatgcattgaataccatg |
8158049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 44 - 107
Target Start/End: Original strand, 4085630 - 4085691
Alignment:
| Q |
44 |
aaacgattcatggcggctggaggaggggtttgatagaagctgcggtgtagttagttccgttttt |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
4085630 |
aaacgattcatggcggca--aggaggggtttgatggaagctgcggtgtagtaagttccgttttt |
4085691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 44318087 - 44318139
Alignment:
| Q |
7 |
ggagcagagaaggcgtggtatggaggactttatgaagaaacgattcatggcgg |
59 |
Q |
| |
|
|||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
44318087 |
ggagtagagaaggcgtggtatggaggaccttgagaagaaacgattcatggcgg |
44318139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 60
Target Start/End: Original strand, 43897378 - 43897426
Alignment:
| Q |
12 |
agagaaggcgtggtatggaggactttatgaagaaacgattcatggcggc |
60 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
43897378 |
agagaaggcgtggtatggaggaccttgaaaagaaacgattcatggcggc |
43897426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University