View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4771_low_7 (Length: 247)
Name: NF4771_low_7
Description: NF4771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4771_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 34570236 - 34570472
Alignment:
| Q |
1 |
tacggccaatgtaggacttcctaatgatgctaatgatggaggaagcacttgaatgttatcaatatcttcccaaaggaagaaaaattttgttttatgccca |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34570236 |
tacggccaatgtagggcttcctaatgatgctaatgatggaggaagcacttgaatgttatcaatatcttcccaaaggaagaaaaattttgttttatgtcca |
34570335 |
T |
|
| Q |
101 |
aacaaatttgcataaaatcccagaacccttgcagaaagaaatagccgaccctgcattagaaagcatggtcatttagtttataaagttcataatgacattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570336 |
aacaaatttgcataaaatcccagaacccttgcagaaagaaatagccgaccctgcattagaaagcatggtcatttagtttataaagttcataatgacattc |
34570435 |
T |
|
| Q |
201 |
taagaattccccgctttgaagcatttatattgtctgt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570436 |
taagaattccccgctttgaagcatttatattgtctgt |
34570472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 155
Target Start/End: Complemental strand, 56176094 - 56175998
Alignment:
| Q |
59 |
tcaatatcttcccaaaggaagaaaaattttgttttatgcccaaacaaatttgcataaaatcccagaacccttgcagaaagaaatagccgaccctgca |
155 |
Q |
| |
|
||||| || |||||||| || || |||||||| || || |||||||||||||||| |||||| || | ||||| |||| |||||| |||||||||| |
|
|
| T |
56176094 |
tcaatgtcctcccaaagcaaaaagaattttgtcttgtgtccaaacaaatttgcatgaaatccaagtattcttgctgaaacaaatagacgaccctgca |
56175998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University