View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4771_low_8 (Length: 238)
Name: NF4771_low_8
Description: NF4771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4771_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 4328368 - 4328159
Alignment:
| Q |
14 |
caaagggacgaatagtaacacagaacatgtcggggacatgaatttgctagtggaaatttaggcagcccatgcaaggtttgagcagaaaccaagatctaag |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328368 |
caaagagacgaatagtaacacagaacatgtcggggacatgaatttgctagtggaaattttggcagcccatgcaaggtttgagcagaaaccaagatctaag |
4328269 |
T |
|
| Q |
114 |
agattcaaattgactacgacgaataaaacacgatccaaaccaaaacccatatctatcaaacaaccagagaaattcccagggtttgctacctcaagagggg |
213 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328268 |
agactcaaattgactacgacgaataaaacacgatccaaaccaaaacccatatctatcaaacaaccagagaaattcccagggtttgctacctcaagagggg |
4328169 |
T |
|
| Q |
214 |
tttagaggtg |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
4328168 |
tttagaggtg |
4328159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University