View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4772-Insertion-3 (Length: 181)
Name: NF4772-Insertion-3
Description: NF4772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4772-Insertion-3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 8 - 181
Target Start/End: Complemental strand, 14172398 - 14172225
Alignment:
| Q |
8 |
ttgacaaatacgcaagttcttggaaatcgtgatttttgttccggggctacttttcagaactccgtaagccagagccaacttctcgctatgaaatgttaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
14172398 |
ttgacaaatacgcaagttcttggaaatcgtgatttttgttccagggctacttttcagaactccgtaagccaaagccagcttctcgctatgaaatgttaaa |
14172299 |
T |
 |
| Q |
108 |
ttcgcctccttttcctcttcagaaacatccatcaaaacgagttctgtcaagggtgtgaatccttccagtttagc |
181 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14172298 |
ttcgcctctttttcctcttcagaaacatccatcaaaacaagttctgtcaaaggtgtgaatccttccagtttagc |
14172225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University