View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4772-Insertion-5 (Length: 159)
Name: NF4772-Insertion-5
Description: NF4772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4772-Insertion-5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 8 - 159
Target Start/End: Complemental strand, 40106148 - 40105994
Alignment:
| Q |
8 |
gaaagaatcttgcatcctttgaaatctaatgattctaccctgcatttgaactaatctataaaagtctttcaccgttcatgaatgaaataaaacttcttat |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40106148 |
gaaagaatcttgcatccttggaaatctaatgattctaccctgcatttgaactaatctataaaagtctttcaccattcatgaatgaaataaaacttcttat |
40106049 |
T |
 |
| Q |
108 |
aagt---actatttcttaactagttccacacatgaacggatgaacccaatccaag |
159 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40106048 |
aagtactactatttcttaactagttccacacatgaacagatgaacccaatccaag |
40105994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University