View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4772_high_7 (Length: 250)
Name: NF4772_high_7
Description: NF4772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4772_high_7 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 23908 - 24148
Alignment:
| Q |
1 |
ctaatttgttgcgtcaaagagttcttcatcaagataacattatgtgcatgggctgctgtggttgttctgaaacagcggtccgtcnnnnnnnagattgtac |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23908 |
ctaatttgttgcgtcgaagagttcttcatcaagataacattatgtgcatgggctgttgtggttgttctgaaacagcggtccgtctttttttagattgtac |
24007 |
T |
 |
| Q |
101 |
gacttttggcagcacatggtacttgctgtggcggtggcttggtattgattttgttccatcaggtgaactcggtgatcattttcatcagttttctcaggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24008 |
gacttttggcagcacatggtacttgctgtggcgatgtcttggtattgattttgttccatcaggtggactcggtgatcattttcatcagttttctcaggtg |
24107 |
T |
 |
| Q |
201 |
gcgggtttgtcgcgttcatcttatttatttttcagaataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24108 |
gcgggtttgtcgcgttcatcttatttatttttcagattaat |
24148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 52401630 - 52401765
Alignment:
| Q |
1 |
ctaatttgttgcgtcaaagagttcttcatcaagataacattatgtgcatgggctgctgtggttgttctgaaacagcggtccgtcnnnnnnnagattgtac |
100 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| |||||||||||||||| || | ||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
52401630 |
ctaatttgttgtgtcgaagagttcttcatcaatataacattatgtgcatatgcggttgtggttgttctgaaacagcggtccatcttttcttagattgtac |
52401729 |
T |
 |
| Q |
101 |
gacttttggcagcacatggtacttgctgtggcggtg |
136 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
52401730 |
gacttttggcagcacgtggtacttgttgtggcggtg |
52401765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University