View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4772_high_9 (Length: 213)

Name: NF4772_high_9
Description: NF4772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4772_high_9
NF4772_high_9
[»] chr8 (4 HSPs)
chr8 (64-213)||(16617135-16617284)
chr8 (136-209)||(16628914-16628987)
chr8 (136-209)||(16637795-16637868)
chr8 (137-201)||(3574105-3574169)
[»] chr4 (1 HSPs)
chr4 (72-155)||(38877635-38877718)


Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 64 - 213
Target Start/End: Original strand, 16617135 - 16617284
Alignment:
64 ggaggaggaagattaccacagctggagggcattttcctttcattgtgaatgaatccagttcaggtgctgcaacgtcagtgaactgattgaaaccttcacc 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||    
16617135 ggaggaggaagattaccacagctggagggcattttcctttcattgtgaatgaatccggttcaggtgccgcaacgtcagtgaactgattgaaaccttcacc 16617234  T
164 tatgctagcacaaacgccaggagtatcaaaggtggttgcaacaaagctgc 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
16617235 tatgctagcacaaacgccaggagtatcaaaggtggttgcaacaaagctgc 16617284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 209
Target Start/End: Original strand, 16628914 - 16628987
Alignment:
136 cgtcagtgaactgattgaaaccttcacctatgctagcacaaacgccaggagtatcaaaggtggttgcaacaaag 209  Q
    |||||||||| ||||||||||| | ||  ||||||||| |||| |||||||||||||||| ||||||| |||||    
16628914 cgtcagtgaattgattgaaaccattacacatgctagcagaaacaccaggagtatcaaagggggttgcatcaaag 16628987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 209
Target Start/End: Original strand, 16637795 - 16637868
Alignment:
136 cgtcagtgaactgattgaaaccttcacctatgctagcacaaacgccaggagtatcaaaggtggttgcaacaaag 209  Q
    |||||||||| ||||||||||| | ||  ||||||||| |||| |||||||||||||||| ||||||| |||||    
16637795 cgtcagtgaattgattgaaaccattacacatgctagcagaaacaccaggagtatcaaagggggttgcatcaaag 16637868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 201
Target Start/End: Original strand, 3574105 - 3574169
Alignment:
137 gtcagtgaactgattgaaaccttcacctatgctagcacaaacgccaggagtatcaaaggtggttg 201  Q
    ||||||||| ||||||||||| | ||  ||||||||| |||| | ||||||||||||||||||||    
3574105 gtcagtgaattgattgaaaccgttacacatgctagcagaaacactaggagtatcaaaggtggttg 3574169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 72 - 155
Target Start/End: Original strand, 38877635 - 38877718
Alignment:
72 aagattaccacagctggagggcattttcctttcattgtgaatgaatccagttcaggtgctgcaacgtcagtgaactgattgaaa 155  Q
    ||||||||||||| | ||||||||||||||||||||||| |||||| ||  |||| | |||||  ||||| |||||||||||||    
38877635 aagattaccacagtttgagggcattttcctttcattgtggatgaattcaagtcagcttctgcagagtcagcgaactgattgaaa 38877718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University