View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4772_low_6 (Length: 399)
Name: NF4772_low_6
Description: NF4772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4772_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 7 - 256
Target Start/End: Original strand, 14172394 - 14172643
Alignment:
| Q |
7 |
gtcaagactgtcataattggattaaaattgtctcaaggatattaaacagagagataattgtgagagatcgcatccgttttcatcaatttgaaggtggatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14172394 |
gtcaagactgtcataattggattaaaattgtctcaaggatattaaacagagagataattgtgagagatcgcatccgttttcatcaatttgaaggtggatg |
14172493 |
T |
 |
| Q |
107 |
ttgctcttgtggagactactggtagtcacttatgagagttaatgctttgttgcattgttgattggccattggctgttacacattctgattatttagagaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
14172494 |
ttgctcttgtggagactactggtagtcacttatgagagttaatgctttgttgcattgttgattggcccttggctgttacacattctgatcatttagagaa |
14172593 |
T |
 |
| Q |
207 |
gaagctgccaaacgtgaaggaaagtgatggaaccaaaatgggaaactctc |
256 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
14172594 |
gaagctgccaaacgtaaaggaaagggatggaaccaaaatgggaaactctc |
14172643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 255 - 389
Target Start/End: Original strand, 14173462 - 14173596
Alignment:
| Q |
255 |
tcattaatcaatttccagtggatacataaaattgtagtagccaacgctaaagatggatgtctgtaaaaatttgggcaccatctgaaattgaaatgcagtg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14173462 |
tcattaatcaatttccagtggatacataaaattgtagtagccaactctaaagatggatgtctgtaaaaatttgggcaacatctgaaattgaaatgcagtg |
14173561 |
T |
 |
| Q |
355 |
tttggacaaaataacacatttcctttttgcctttg |
389 |
Q |
| |
|
||| |||||||||||||| |||||||||||||||| |
|
|
| T |
14173562 |
ttttgacaaaataacacagttcctttttgcctttg |
14173596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University