View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4773_high_7 (Length: 284)
Name: NF4773_high_7
Description: NF4773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4773_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 39263768 - 39263493
Alignment:
| Q |
1 |
tcatcaccaattctagtaccagcaacatgatcaagtccaagctctttaatcagtgacttgacccttgaacattgttgttgtggaggaagctttagcctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39263768 |
tcatcaccaattctagtaccagcaacatgatcaagtccaagctctttaatcagtgacttgacccttgaacattgttgttgttgaggaagctttagcctta |
39263669 |
T |
|
| Q |
101 |
gttttgcactgaacatcatggtttcttcaactgtaagtaagggaaacaaagtgtccctttgagtaacatatcctgatagctttctgaactgagatttgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39263668 |
gttttgcactgaacatcatggtttcttcaactgtaagtaagggaaacaaagtgtccttttgagtaacatatcctgatagctttctgaactgagatttgtc |
39263569 |
T |
|
| Q |
201 |
tactggcttctggttcaacaacacagaccctttttggggtctgtgtttacctgctaggatctcaagaagtgatgat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39263568 |
tactggcttctggttcaacaacacagaccctttttgtggtctgtgtttacctgctaggatctcaagaagtgatgat |
39263493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 24 - 197
Target Start/End: Complemental strand, 44067472 - 44067299
Alignment:
| Q |
24 |
aacatgatcaagtccaagctctttaatcagtgacttgacccttgaacattgttgttgtggaggaagctttagccttagttttgcactgaacatcatggtt |
123 |
Q |
| |
|
||||||| ||| |||||||||| ||||| |||||| ||| | | | | ||| || ||||| ||| |||| | ||||||||||||| |||||||||||| |
|
|
| T |
44067472 |
aacatgactaagaccaagctcttgaatcaatgacttaaccttacagcttagtttttctggagaaagatttaactttagttttgcactaaacatcatggtt |
44067373 |
T |
|
| Q |
124 |
tcttcaactgtaagtaagggaaacaaagtgtccctttgagtaacatatcctgatagctttctgaactgagattt |
197 |
Q |
| |
|
|||||||||||||||||||| || | ||||| |||| |||||||| ||||| | ||||||||||||||||| |
|
|
| T |
44067372 |
tcttcaactgtaagtaaggggaaaagggtgtctttttgtgtaacataccctgaaatttttctgaactgagattt |
44067299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University