View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4773_high_9 (Length: 239)
Name: NF4773_high_9
Description: NF4773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4773_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 122 - 184
Target Start/End: Complemental strand, 17335907 - 17335845
Alignment:
| Q |
122 |
gagtaagaaatggttaaaatgacacatataactaatattgttatatcagaatgacacatcatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17335907 |
gagtaagaaatggttaaaatgacacatataactaatattgttatatcagaatgacacatcatt |
17335845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 17336034 - 17335943
Alignment:
| Q |
1 |
atcttgtca-tgaggtgaatggatcgatcgcccttctttattgtttaggacggggtagaggtgatgaggggaaggagacgagggagaaaatc |
91 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
17336034 |
atcttgtcaatgaggtgaatgggtcgatcacccttctttattgtttaggtcggggtagaggtgatgaggggaaagagaagagggggaaaatc |
17335943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University