View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4773_low_11 (Length: 294)
Name: NF4773_low_11
Description: NF4773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4773_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 8 - 283
Target Start/End: Original strand, 18926095 - 18926370
Alignment:
| Q |
8 |
tccaatgatctatctcacccgcatcaagtattgtcaaccaaaacgtcnnnnnnncataagattgtcttagtttccttagagatcaccttagcttctgtta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18926095 |
tccaatgatctatctcacccgcatcaagtattgtcaaccaaaacgtcaaaaaaatataagattgtcttagtttccttagagatcaccttagcttctgtta |
18926194 |
T |
|
| Q |
108 |
gtgtacttatggtgggtttcaccatttattggcaatggcgatatcgtgatgaggattctatggaagataactcgtcagaaacaaagagtgaagggttgcc |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18926195 |
gtgtgcttatggtgggtttcaccatttattggcaatggcgatatcgtgatgaggattctatggaagataactcgtcagaaacaaagagtgaagggttgcc |
18926294 |
T |
|
| Q |
208 |
atctttaccgccccatttgtgccgctactttacaattgcaaagataaaagcagccacaaataactttgatgatgat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18926295 |
atctttaccgccccatttgtgccgctactttacaattgcagagataaaagcagccacaaataactttgatgatgat |
18926370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 8e-24; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 207 - 283
Target Start/End: Complemental strand, 4661365 - 4661289
Alignment:
| Q |
207 |
catctttaccgccccatttgtgccgctactttacaattgcaaagataaaagcagccacaaataactttgatgatgat |
283 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||| | |||||||||||| ||||||||||||||| |
|
|
| T |
4661365 |
catctttgccgccccatttgtgccgctactttacaattgcagagatcagagcagccacaaaaaactttgatgatgat |
4661289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 283
Target Start/End: Complemental strand, 4666501 - 4666420
Alignment:
| Q |
202 |
gttgccatctttaccgccccatttgtgccgctactttacaattgcaaagataaaagcagccacaaataactttgatgatgat |
283 |
Q |
| |
|
|||| ||||||| ||||||||||||||||| | ||||||||||||| |||| | |||||||||||| |||||||| |||||| |
|
|
| T |
4666501 |
gttgtcatctttgccgccccatttgtgccggtcctttacaattgcagagatcagagcagccacaaacaactttgacgatgat |
4666420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 186 - 282
Target Start/End: Complemental strand, 4636439 - 4636343
Alignment:
| Q |
186 |
aaacaaagagtgaagggttgccatctttaccgccccatttgtgccgctactttacaattgcaaagataaaagcagccacaaataactttgatgatga |
282 |
Q |
| |
|
||||||||| |||||| | | || ||||||| || |||||||||||||||||||||| ||| |||| | |||||||||||| ||||| |||||||| |
|
|
| T |
4636439 |
aaacaaagaatgaaggttcgtcaactttaccatcctatttgtgccgctactttacaatcgcagagatcagagcagccacaaaaaacttcgatgatga |
4636343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 198 - 281
Target Start/End: Complemental strand, 4653090 - 4653007
Alignment:
| Q |
198 |
aagggttgccatctttaccgccccatttgtgccgctactttacaattgcaaagataaaagcagccacaaataactttgatgatg |
281 |
Q |
| |
|
|||||| | ||||||| || || |||||||| |||| ||| ||||| ||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
4653090 |
aagggtcgtcatctttgccaccacatttgtgtcgctccttcacaatcgcagagatcaaagcagccacaaataacttcgatgatg |
4653007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 210 - 281
Target Start/End: Complemental strand, 4672198 - 4672127
Alignment:
| Q |
210 |
ctttaccgccccatttgtgccgctactttacaattgcaaagataaaagcagccacaaataactttgatgatg |
281 |
Q |
| |
|
|||| |||||||| |||||||| | ||||||||| ||| |||| |||||||||||||| ||||| ||||||| |
|
|
| T |
4672198 |
ctttgccgccccacttgtgccgttcctttacaatcgcagagatcaaagcagccacaaacaacttcgatgatg |
4672127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 4630456 - 4630401
Alignment:
| Q |
221 |
catttgtgccgctactttacaattgcaaagataaaagcagccacaaataactttga |
276 |
Q |
| |
|
|||||||| |||||||||||||| || |||| |||||||||||||| |||||||| |
|
|
| T |
4630456 |
catttgtgtcgctactttacaatcgcggagatcaaagcagccacaaacaactttga |
4630401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University