View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4773_low_14 (Length: 239)

Name: NF4773_low_14
Description: NF4773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4773_low_14
NF4773_low_14
[»] chr5 (2 HSPs)
chr5 (122-184)||(17335845-17335907)
chr5 (1-91)||(17335943-17336034)


Alignment Details
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 122 - 184
Target Start/End: Complemental strand, 17335907 - 17335845
Alignment:
122 gagtaagaaatggttaaaatgacacatataactaatattgttatatcagaatgacacatcatt 184  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17335907 gagtaagaaatggttaaaatgacacatataactaatattgttatatcagaatgacacatcatt 17335845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 17336034 - 17335943
Alignment:
1 atcttgtca-tgaggtgaatggatcgatcgcccttctttattgtttaggacggggtagaggtgatgaggggaaggagacgagggagaaaatc 91  Q
    ||||||||| |||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||| |||| ||||| |||||||    
17336034 atcttgtcaatgaggtgaatgggtcgatcacccttctttattgtttaggtcggggtagaggtgatgaggggaaagagaagagggggaaaatc 17335943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University