View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4774-Insertion-21 (Length: 126)
Name: NF4774-Insertion-21
Description: NF4774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4774-Insertion-21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 5116527 - 5116409
Alignment:
| Q |
8 |
gaatatgcattttctcttgtttcaaacgttctgattaaacttctttcatcttaaaacagggctagagttgcattaataacttatcttccaaacagactca |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
5116527 |
gaatatgccttttctcttgtttcaaacgttctaattaaacttctttcatcttaaaacagggctagagttgcattaacaacttatcttccaaacaggctca |
5116428 |
T |
 |
| Q |
108 |
aagatgccaatctcatcaa |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5116427 |
aagatgccaatctcatcaa |
5116409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University