View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4774_low_4 (Length: 427)
Name: NF4774_low_4
Description: NF4774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4774_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 2e-84; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 166 - 362
Target Start/End: Original strand, 32400110 - 32400312
Alignment:
| Q |
166 |
tgtttcatttccaaaaagatcccgataaaaatcacataccgacaaatgtttgaaatccacataaaacaaaatatagttgaatttttcggatttccttttg |
265 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32400110 |
tgtttcatatccaaaaagattccgataaaaatcacataccgacacaagtttgaaatccacataaaacaaaatatagttgaatttttcggatttccttttg |
32400209 |
T |
 |
| Q |
266 |
tggaaaccactcaaatcaaattaaattttagaaccga---atcagtgtgcatatataaatt---atattcatttatttttaaaatttacatacgatattc |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32400210 |
tggaaaccactcaaatcaaattaaattttagaaccgaattatcagtgtgcatatataaattataatattcatttatttttaaaatttacatacgatattc |
32400309 |
T |
 |
| Q |
360 |
att |
362 |
Q |
| |
|
||| |
|
|
| T |
32400310 |
att |
32400312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 12 - 144
Target Start/End: Original strand, 32399989 - 32400121
Alignment:
| Q |
12 |
tatactaagtgaagtcatcaaaaaatgagtaggtatcctctcactagcaatcttttgctcatttttcgtatttgtttgtattattatggtattagttggt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32399989 |
tatactaagtgaagtcatcaaaaaatgagtaggtatcctctcactagcaatcttttgctcatttttcgtatttgtttgtattattatggtattcgttggt |
32400088 |
T |
 |
| Q |
112 |
taatattaccacttaataagatgtttcatatcc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32400089 |
taatattaccacttaataagatgtttcatatcc |
32400121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 371 - 411
Target Start/End: Original strand, 32400635 - 32400675
Alignment:
| Q |
371 |
ttgcatgagatattttttaaatgaatgcatcctaagatcgt |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32400635 |
ttgcatgagatattttttaaatgaatgcatcctaagatcgt |
32400675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University