View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4774_low_8 (Length: 369)
Name: NF4774_low_8
Description: NF4774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4774_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 14 - 349
Target Start/End: Complemental strand, 40023387 - 40023052
Alignment:
| Q |
14 |
gaagggtatgacataggctaccatcgatcatattttggtgacaaaggggagctagggttacgacgacacacatgaaccaaaatgtgtgctaataataatc |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
40023387 |
gaaggttatgacataggctaccatcgatc-tattttggtgacaaaggggagctagggttacgacgacacacatgaaccaaaatgtgtcctaataat---c |
40023292 |
T |
 |
| Q |
114 |
aggcttctagttgagacattaatgaatgcttggacatcgtgtaggtttatcattgctttaacaaaaaatggaag----tatcaggatctatgtaaacaac |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
40023291 |
aggcttctagtcgagacattaatgaatgcttggacatcgtgtaggtttgtcattgctttaactgaaaatggaagggagtatcaggatctatgtaaacaac |
40023192 |
T |
 |
| Q |
210 |
catggccacgtaagggtgagaagttacacttaagaatgggtattgagatggaggagaagccggtggaaaacacttgcaatgggggtaataataagaaaca |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40023191 |
catggccatgtaagggtgagaagttacacttaagaatgggtattgagatggaggagaagccggtggaaaacacttgcaatgggggtaataataagaaaca |
40023092 |
T |
 |
| Q |
310 |
tctagccatcgcggtgaaacataacagttcacttaagcag |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40023091 |
tctagccatcgcggtgaaacataacagttcacttaagcag |
40023052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University